qPCR primer design - possible off-target

[PDavidsen]

qPCR primer design - possible off-target

• Quote

Post by PDavidsen » Sat Apr 30, 2011 2:28 pm

Hi all,

I'm designing primers for SYBRGreen-based qPCR (using the software Primer3).
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:

Code: Select all

product length = 196
Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3134  C..G..C.C.G.........  3153

Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3329  C......C.C.AG.......  3310

Anyone how would like to share their thoughts on this potential "forward-forward" problem.

NB. The annealing temperature will be 60 C

Kind regards

Last edited by PDavidsen on Sat Apr 30, 2011 9:10 pm, edited 2 times in total.

[JackBean]

• Quote

Post by JackBean » Sat Apr 30, 2011 7:46 pm

does that mean, that it binds with five residues with such big gaps? I wouldn't care about that.

[PDavidsen]

• Quote

Post by PDavidsen » Sat Apr 30, 2011 8:23 pm

No, the dots mean perfect complementarity between primer and template. So the forward primer will/might anneal with 5 mismatches two places on the same template (196 bp between the two binding sites)

[JackBean]

• Quote

Post by JackBean » Sun May 01, 2011 9:10 am

I see now

Yes, there is posibility, that you could get some amplicon. You could try more stringent conditions or some probe for your gene

[canalon]

• Quote

Post by canalon » Mon May 02, 2011 2:21 pm

It should still work, but that will decrease your PCR efficiency, and if you are working with multiple strains/subjects, the effect will vary and not be competely correlate with your control. So I would avoid that particular combination if at all possible.