qPCR primer design - possible off-target
Moderators: honeev, Leonid, amiradm, BioTeam
qPCR primer design - possible off-target
Hi all,
I'm designing primers for SYBRGreen-based qPCR (using the software Primer3).
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:
Anyone how would like to share their thoughts on this potential "forward-forward" problem.
NB. The annealing temperature will be 60 C
Kind regards
I'm designing primers for SYBRGreen-based qPCR (using the software Primer3).
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:
Code: Select all
product length = 196
Forward primer 1 AAGCAGAAAACCAGCAGCTC 20
Template 3134 C..G..C.C.G......... 3153
Forward primer 1 AAGCAGAAAACCAGCAGCTC 20
Template 3329 C......C.C.AG....... 3310
Anyone how would like to share their thoughts on this potential "forward-forward" problem.
NB. The annealing temperature will be 60 C
Kind regards
Last edited by PDavidsen on Sat Apr 30, 2011 9:10 pm, edited 2 times in total.
It should still work, but that will decrease your PCR efficiency, and if you are working with multiple strains/subjects, the effect will vary and not be competely correlate with your control. So I would avoid that particular combination if at all possible.
Patrick
Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
Who is online
Users browsing this forum: No registered users and 6 guests