Search found 42 matches

by Helics
Tue Feb 18, 2014 10:49 am
Forum: Molecular Biology
Topic: Annealing Temparature
Replies: 3
Views: 5646

Annealing Temparature

My Gene of Interest is 2kb long
Primer-F : GCTCTAGAGTGATAGTAGGCATGG
Primer-R : GCGATATCCTACACCCAAGCTGC


I used the following program:

94C 1min
94C 2min
56C 1min
72C 2min

final elongation 72C 7min

I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(
by Helics
Sat Jan 18, 2014 9:36 am
Forum: Molecular Biology
Topic: Taq Buffer ?
Replies: 1
Views: 2437

Taq Buffer ?

why Taq DNA Polymerase Buffers containing Gelatin ?
by Helics
Mon Dec 16, 2013 3:38 pm
Forum: Cell Biology
Topic: WHAT IS IONOPHORE
Replies: 1
Views: 3183

WHAT IS IONOPHORE

is it possible to build desired ion containing ionophore ?
by Helics
Tue Oct 29, 2013 8:52 am
Forum: Molecular Biology
Topic: How
Replies: 4
Views: 5624

Re: How

multiple gene insertion by conventional transformation is very time consuming and required selectable marker genes :( . So I have to do different..................? Do you have any idea ????? :(
by Helics
Tue Oct 22, 2013 12:41 pm
Forum: Molecular Biology
Topic: How
Replies: 4
Views: 5624

How

How do i insert two gene at same time inside a bacterial genome ?
please, share any link . :(
by Helics
Tue Sep 10, 2013 6:36 pm
Forum: Molecular Biology
Topic: Gene Products
Replies: 2
Views: 3017

Gene Products

Can anyone please help me how to search the whole genomes of Mo10 V.Cholerae and its respective gene products and its functions.

please share any any link. thank you.
by Helics
Tue Sep 10, 2013 6:34 pm
Forum: Microbiology
Topic: Gene Products
Replies: 3
Views: 11063

Gene Products

Can anyone please help me how to search the whole genomes of Mo10 V.Cholerae and its respective gene products and its functions.

please share any any link. thank you.
by Helics
Fri Aug 02, 2013 7:56 pm
Forum: Microbiology
Topic: Antibody Coating
Replies: 1
Views: 3822

Antibody Coating

How Do I coat a antigen specific antibody on the surface of the Micro triter plate ?
please Share any Link.
by Helics
Fri Jul 26, 2013 8:48 am
Forum: Microbiology
Topic: Amino acid sequence
Replies: 1
Views: 3281

Amino acid sequence

How do I find amino acid sequence for different sub-units for cholera toxin ? ?
Please help me. Share link or etc.
by Helics
Wed Jul 03, 2013 3:50 pm
Forum: Ecology
Topic: interdemic extinctions
Replies: 1
Views: 11939

interdemic extinctions

What is interdemic extinctions.
by Helics
Sat Feb 09, 2013 7:10 am
Forum: Molecular Biology
Topic: Initiating Codon
Replies: 0
Views: 1338

Initiating Codon

It is not necessary to presence of "AUG" as initiating codon in in-vitro translational experiment. But WHY ?
by Helics
Fri Feb 08, 2013 3:24 am
Forum: Molecular Biology
Topic: SELEX
Replies: 3
Views: 3437

sorry,
actually I want to know its extended application.