Search found 3 matches

by PDavidsen
Sat Apr 30, 2011 8:23 pm
Forum: Molecular Biology
Topic: qPCR primer design - possible off-target
Replies: 4
Views: 3126

No, the dots mean perfect complementarity between primer and template. So the forward primer will/might anneal with 5 mismatches two places on the same template (196 bp between the two binding sites)
by PDavidsen
Sat Apr 30, 2011 2:28 pm
Forum: Molecular Biology
Topic: qPCR primer design - possible off-target
Replies: 4
Views: 3126

qPCR primer design - possible off-target

Hi all, I'm designing primers for SYBRGreen-based qPCR (using the software Primer3). I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is: product length = 196 Forward primer 1 AAGCAGAAAACCAGCAGCTC 20 Template 3134 C....
by PDavidsen
Mon Apr 04, 2011 4:49 pm
Forum: Bioinformatics
Topic: Search for differentially exp genes using SAM
Replies: 0
Views: 2751

Search for differentially exp genes using SAM

Hi all, I'm new to "Significance Analysis of Microarrays (SAM) - so could use some input I have two classes (CON and DM) with 8 subjects in each. Each 'experimental unit' has been measured at 3 different time points (T1, T2, and T3). Thus, I have set the response type/format to "Time cours...