Search found 15 matches

by SystemRGB
Sun Jun 09, 2019 11:46 am
Forum: Evolution
Topic: New theory of evolution
Replies: 4
Views: 16279

Re: New theory of evolution

see this again
by SystemRGB
Wed Oct 07, 2015 1:39 pm
Forum: Evolution
Topic: New theory of evolution
Replies: 4
Views: 16279

Re: New theory of evolution

* It can be assume that extinction events are connected clearly with logistic development. Each such event can mean a jump on higher level of evolution. For example last Cretaceous-Paleogene extinction event of reptilia tied in with transition on higher level of evolutional development and with a ca...
by SystemRGB
Wed Oct 07, 2015 12:26 pm
Forum: Molecular Biology
Topic: DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.
Replies: 3
Views: 7905

Re: DNA sequence, Nucleotide sequence - Sequence of 3870 nuc

This type of sequence can be a recording of complete genome of ssDNA (single stranded DNA) virus. For example Porcine circovirus-1 from the genus Circovirus has a single-chain genome of 1759 nucleotides long.
by SystemRGB
Wed Sep 23, 2015 12:10 am
Forum: Molecular Biology
Topic: DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.
Replies: 3
Views: 7905

DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.

https://upload.wikimedia.org/wikipedia/commons/1/12/DNA_sequence%2C_Nucleotide_sequence.gif?uselang=pl Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak, above sequence of 3870 nucleotides - ATCCTTGTTATTGCAGTAGCTCAGTACTTGCACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTT...
by SystemRGB
Fri Aug 28, 2015 4:53 pm
Forum: Molecular Biology
Topic: Visualization of DNA, nucleotide sequence
Replies: 0
Views: 2220

Visualization of DNA, nucleotide sequence

http://wm42.inbox.com/thumbs/3_40f601_2de5a74_oG.gif.thumb TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT CCGGTATGAATTCTCCGCGCAA...
by SystemRGB
Tue Aug 18, 2015 1:34 pm
Forum: Genetics
Topic: Visualization of sequences of nucleotides, sequence of DNA
Replies: 4
Views: 7988

Re: Visualization of sequences of nucleotides, sequence of D

the author of visualization and application: Gregory Podgorniak, Poland (2015)
by SystemRGB
Sun Aug 02, 2015 10:31 pm
Forum: Genetics
Topic: Visualization of sequences of nucleotides, sequence of DNA
Replies: 4
Views: 7988

Re: Visualization of sequences of nucleotides, sequence of D

Sequence of 744 nucleotides http://studia.scienceontheweb.net/diagrams/Sequence_of_774_nucleotides.gif GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAG...
by SystemRGB
Sun Aug 02, 2015 9:17 pm
Forum: Genetics
Topic: Visualization of sequences of nucleotides, sequence of DNA
Replies: 4
Views: 7988

Visualization of sequences of nucleotides, sequence of DNA

Sequence of 215 nucleotides x 3 http://studia.scienceontheweb.net/diagrams/Sequence_of_215_nucleotides_x3.gif TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGT...