Dictionary » S » Stop codon

Stop codon

stop codon --> termination codon

(Science: molecular biology) The three codons, UAA known as ochre, UAG as amber and UGA as opal, that do not code for an amino acid but act as signals for the termination of protein synthesis.

They are not represented by any tRNA and termination is catalysed by protein release factors. There are two release factors in e. Coli, RF1 recognises UAA and UAG, RF2 recognises UAA and UGA. Eukaryotes have a single gTP requiring factor, eRF.

See: ochre suppressor, amber suppressor.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Tricky translation question, can someone help please?

... the DNA and start transcription. You need to start with a methionine codon (AUG) and then count triplets (including the methionine) until you reach the stop (which you don't count as an amino acid).

See entire post
by jonmoulton
Mon Jun 15, 2009 11:29 pm
 
Forum: Molecular Biology
Topic: Tricky translation question, can someone help please?
Replies: 1
Views: 131

Tricky translation question, can someone help please?

... a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC ...

See entire post
by 0rion
Mon Jun 15, 2009 5:35 pm
 
Forum: Molecular Biology
Topic: Tricky translation question, can someone help please?
Replies: 1
Views: 131

need help

... stretch of sequence of length more than 20 amino acids and having start codon, stop codon in the same frame) which have not been reported as genes (non-genes). The validation ...

See entire post
by bhatig
Tue Jun 09, 2009 5:19 am
 
Forum: Bioinformatics
Topic: need help
Replies: 1
Views: 185

Re: Retained Intron through Translation

When an intron is included, you are likely to have a stop codon in-frame in the intron. This triggers nonsense-mediated decay of the mRNA. Frameshifting downstream ...

See entire post
by jonmoulton
Tue May 05, 2009 11:52 pm
 
Forum: Genetics
Topic: Retained Intron through Translation
Replies: 1
Views: 445

Re: Homework help!

... of nucleotides - therefore we have a total of 18 nucleotides. B) A codon consists of three (3) nucleotides - 18/3 = 6. C) UAC UGA GCG AAU GCA ... Threonine 3. CGC = Arginine 4. UUA = Leucine 5. CGU = Arginine 6. UAA = Stop [Not entirely sure about the last, but the sequencing seems to work ...

See entire post
by Mech
Thu Mar 19, 2009 12:25 pm
 
Forum: Genetics
Topic: Homework help!
Replies: 5
Views: 573
View all matching forum results

This page was last modified 21:16, 3 October 2005. This page has been accessed 2,426 times. 
What links here | Related changes | Permanent link