Dictionary » R » Rna

Rna

Rna

(Science: molecular biology) A nucleic acid found in all living cells. Plays a role in transferring information from dNA to the protein-forming system of the cell. (biochemistry) a long linear polymer of nucleotides found in the nucleus but mainly in the cytoplasm of a cell where it is associated with microsomes; it transmits genetic information from dna to the cytoplasm and controls certain chemical processes in the cell; ribonucleic acid is the genetic material of some viruses.A nucleic acid similar to that of dna, thought the deoxyribose acid is replaced with ribose sugar and all thymine bases are replaced with uracil. Rna is a vital component of protein synthesis as it is able to read the genetic blueprint found in dna to make.


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: I Need help in designing RNAi :?:

Hi Yuli, By its nature, RNAi is not very specific. See this blog post for a brief discussion and some citations on the topic of RNAi specificity: http://blogs.myspace.com/index.cfm?fuseaction=blog.view&blogId=496461710 ...

See entire post
by jonmoulton
Thu Jun 25, 2009 6:46 pm
 
Forum: Molecular Biology
Topic: I Need help in designing RNAi :?:
Replies: 1
Views: 26

Re: The end of creation?

We have not currently been able to create a living entity, arguably RNA from prebiotic soup elements. We have gotten close to it but there are still major holes such as the synthesis of some nucleotide bases. Apart from that, our planets vast amounts of life ...

See entire post
by Jesse2504
Sun Jun 21, 2009 3:37 pm
 
Forum: Cell Biology
Topic: The end of creation?
Replies: 7
Views: 108

Tricky translation question, can someone help please?

... to an amino acid, and when the three bases are UAA UAG or UGA the peptide stops. Next, DNA is read in the 3' to 5' direction, so the strand of RNA should read: 5' (AUGACGUAUAA)UGACCGUACAUGAGUAAUACAUAAAUCAG 3' Have i done it right so far? Because this is where i lose the plot, i'm not 100% sure ...

See entire post
by 0rion
Mon Jun 15, 2009 5:35 pm
 
Forum: Molecular Biology
Topic: Tricky translation question, can someone help please?
Replies: 1
Views: 71

Re: the difference between Viruses and Bacteria.

... to invade a 'host' cell and take over its machinery in order to be able to make more virus particles. Viruses consist of genetic materials (DNA or RNA) surrounded by a protective coat of protein. They are capable of latching onto cells and getting inside them. Bacteria are organisms made up of ...

See entire post
by laserlipo
Wed Jun 10, 2009 6:37 am
 
Forum: Microbiology
Topic: the difference between Viruses and Bacteria.
Replies: 5
Views: 1701

Any SOLID arguments against evolution?

4. tRNA--One of the most unexplainable things I have ever seen is tRNA--transfer RNA. As you know it brings each corresponding amino acid at the proper time and in the proper sequence. No one can explain how--it just does! ...

See entire post
by alextemplet
Wed Jun 03, 2009 12:39 am
 
Forum: Evolution
Topic: Any SOLID arguments against evolution?
Replies: 106
Views: 6584
View all matching forum results

This page was last modified 07:20, 9 March 2007. This page has been accessed 17,049 times. 
What links here | Related changes | Permanent link