
|
|
Dictionary » P » Plot Plotplot 1. A small extent of ground; a plat; as, a garden plot. 2. A plantation laid out. 3. A plan or draught of a field, farm, estate, etc, drawn to a scale. Origin: AS. Plot; cf. Goth. Plats a patch. Cf. Plat a piece of ground. 1. Any scheme, stratagem, secret design, or plan, of a complicated nature, adapted to the accomplishment of some purpose, usually a treacherous and mischievous one; a conspiracy; an intrigue; as, the rye-house Plot. I have overheard a plot of death. (Shak) O, think what anxious moments pass between The birth of plots and their last fatal periods! (Addison) 2. A share in such a plot or scheme; a participation in any stratagem or conspiracy. And when christ saith. Who marries the divorced commits adultery, it is to be understood, if he had any plot in the divorce. (milton) 3. Contrivance; deep reach thought; ability to plot or intrigue. A man of much plot. 4. A plan; a purpose. No other plot in their religion but serve got and save their souls. 5. In fiction, the story of a play, novel, romance, or poem, comprising a complication of incidents which are gradually unfolded, sometimes by unexpected means. If the plot or intrigue must be natural, and such as springs from the subject, then the winding up of the plot must be a probable consequence of all that went before. (pope) Synonym: [[intrigue, stratagem, conspiracy, cabal, combination, contrivance. Origin: Abbrev. From complot. ![]()
Please contribute to this project, if you have more information about this term feel free to edit this page ![]()
Results from our forumtransform xy-data to xyz-dataI do have a data set for albumine and calcium (n=7000). I would like to transform it to xyz-data for making a 3D-mesh plot. I'm using SigmPlot. Does anyone have suggestion how to generate z-data?
See entire post
Re: How to find motif frequenciesI dont have enough experience to give lab advices..but you could use hydropathy plot for determing hydrophilic and hydrophobic parts of protein thus predicting its conformation
See entire post
product-vs-time experiment of amylase... to me) today in a biochemistry lab and had to determine the velocity of the reaction for three different substrate conditions. Generally, when I plot the graphs, there are 3 different lines, corresponding to the different concentrations. However today when I plotted my results for product-vs-time ...
See entire post
Re: Lab of Vmax and KM... approaches Vmax asymptotically as the substrate concentration increases. However, changing other conditions can change the Michaelis–Menten plot -- for instance, a different pH or a different temperature can lead to a different relationship between [S] and Vmax.
See entire post
Tricky translation question, can someone help please?... so the strand of RNA should read: 5' (AUGACGUAUAA)UGACCGUACAUGAGUAAUACAUAAAUCAG 3' Have i done it right so far? Because this is where i lose the plot, i'm not 100% sure what the promoter region is, and the first codon is UGA... therefore it should only be 1 amino acid long? :S Thanks in advance ...
See entire post
This page was last modified 21:16, 3 October 2005. This page has been accessed 1,797 times. |
© Biology-Online.org. All Rights Reserved.
Register | Login
| About Us | Contact Us | Link to Us | Disclaimer & Privacy
Science Network - Braintrack.com - University Directory | Chemicool.com - Chemistry