Overlap

... at least concede that evolutionary psychology contains a component of biology. Edward O Wilson's book Consilience explains how disciplines often overlap in order to create new fields that can make significant contributions to knowledge that affect the constituent disciplines. I disagree with ...

See entire post

... snake species you would have to construct a fairly elaborate algorithm. You would have to take into account snake population ratios and their overlap with major human population centers. You would also have to factor toxicity levels, number of victims bitten who survived, propensity for the ...

See entire post

Thanks for the replies everyone! jonmoulton, I like the idea of getting the BA chem. There is a lot of overlap between the chem and bio degrees at my university. They also offer a BA in chem with biochemistry emphasis, which overlaps even more. I'll look into the possibility ...

See entire post

... by Phil Holler and Jianzhu Chen, MIT). The 5 codon amino acid degeneracy library in CDR3α of the 2C TCR (GFASA, positions 99–103) was created by overlap extension PCR. SOE-PCR-overlap regions between two preSOE products are underlined. AgeI upstream primer, sense strand: 5′ GGAATTAGATCCACCGGTCGCCGCCATGCTCCTGGACTCCTCCCAGTGCTGGGG ...

See entire post

... If your sequences are too short, it will be nearimpossible to get a consensus because they won't differ enough to provide enough significant overlap. Sequences the size of a PCR primer (for the exact same reason) would probably be the minimum to assemble something.

See entire post