Home Forum Dictionary Articles Tutorials Books Directory Share your work


Edit page | Page history | Printable version

Dictionary » M » Mature mRNA

Mature mRNA

Definition

noun

The completely processed mRNA molecule in the cell of eukaryotes.


Supplement

A pre-mRNA molecule becomes a mature mRNA molecule after having undergone the following processes:

  • 5' cap addition – the addition of a 5'cap to the front or 5' end of the pre-mRNA molecule at the start of transcription
  • splicing – removal of any introns (non-coding sequences) and the splicing together of exons (protein-coding sequences)
  • editing – in some instances, the nucleotide composition is altered
  • polyadenylation – a poly a tail is added to the free 3' end at the cleavage site

Once these processes are completed the mature mRNA can then be transported from the nucleus into the cytoplasm for protein translation.


See also: pre-mRNA


Please contribute to this project, if you have more information about this term feel free to edit this page



Results from our forum


Re: Help with sequencing DNA.

For this mRNA: AAGGGUGUAGAAGCUAAGGGU The antisense is likely: ACCCTTAGCTTCTACACCCTT The sense is likely: ... is that there might be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron. If there is ...

See entire post
by jonmoulton
Mon Jun 29, 2009 4:47 pm
 
Forum: Molecular Biology
Topic: Help with sequencing DNA.
Replies: 3
Views: 189

Re: Gene giving rise to Protein

... are removed in a process called splicing inside the nucleus before the mRNA is sent out into the cytoplasm for translation. Humans have less than ... occassions or in other tissues it is not. So it becomes a part of the mature mRNA which when translated yields a different protein which has different ...

See entire post
by manohar
Tue Mar 24, 2009 6:15 am
 
Forum: Cell Biology
Topic: Gene giving rise to Protein
Replies: 2
Views: 348

Clinical trial: Morpholinos for Duchenne molecular dystrophy

... targeted to modify splicing of exon 51 in the human Dystrophin pre-mRNA transcript, excluding exon 51 from the mature mRNA. This is an experimental therapeutic for some mutations causing Duchenne muscular ...

See entire post
by jonmoulton
Tue Feb 17, 2009 11:58 pm
 
Forum: Human Biology
Topic: Clinical trial: Morpholinos for Duchenne molecular dystrophy
Replies: 1
Views: 448

Morpholino splice modification and translation blocking

This animation shows Morpholino oligos modifying splicing of pre-mRNA and blocking translation of mature mRNA. Animation by Pathworks ( http://pathworks.net/HOME.html ). Morpholino.mov

See entire post
by jonmoulton
Mon Oct 13, 2008 11:29 pm
 
Forum: Biology Movies
Topic: Morpholino splice modification and translation blocking
Replies: 0
Views: 1212

Re: splicing MO vs translation MO

... oligo (e1i1) is most likely to cause insertion of intron 1 into the mature mRNA sequence. You should confirm this by RT-PCR if possible. Look at the intronic sequence ...

See entire post
by jonmoulton
Mon Aug 18, 2008 6:19 pm
 
Forum: Molecular Biology
Topic: splicing MO vs translation MO
Replies: 14
Views: 2210
View all matching forum results

This page was last modified 22:50, 19 August 2009. This page has been accessed 16 times. 
What links here | Related changes | Permanent link