Codons

... the similarity between all organisms at the most basic molecular level, even when there are no reason for those (say the correspondance between codons and amino-acids) it is usually supposed that all current living organisms came from a unique source. This is implicit when you hear about LUCA ...

See entire post

... eyes, here it is... 15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA. 5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5' How many amino acids ...

See entire post

Exactly right - count the codons. Then translate a section where you think your domain of interest starts to see whether you have correctly identified the place on the RNA that encodes those amino acids.

See entire post

... than end up with nothing at all due to time constraints. I recently added a good batch of them including the predicted reason for there being codons. They seem to fit in well but where it looks like a hasty cut-paste from some rambling I had somewhere, it probably was. They in time find the ...

See entire post

... per codon. This is necessary for a design that can code for twenty-something amino acids from the one of four possible nucleotides. The reason codons exist, is because such a design is necessary to achieve the next emergent level. In the very beginning before there was life, molecular forces ...

See entire post