3-methoxy-4-hydroxymandelic acid test

Hey Guys, So i got my biology test back, and I did pretty well, but there was one on there that whacked me between ... 3' 3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5' How many amino acids long will the smalll protein encoded by this gene be? a.3 b.4 c.5 d.6 e.7 Ok, ...

See entire post

... entire process has been observed before your eyes. There is no way to test events of the past which have been presented in numerous hypotheses ... saying that primarily if you took the single atoms out of their amino acid arrangements, they could bond a vast number of ways, That's true but ...

See entire post

... It grew at 4 degree celsius and 25 degree celsius. Citrate test positive, it grew only at a 7pH. Grew on plates with glucose, glucose and amino acids, glucose, amino acids and yeast extract, and just amino acids. It grew without oxygen ...

See entire post

I know that I have the correct bacteria because I did all the tests needed to determine which one I had. I had narrowed it down to 3 bacteria ... do an endospore stain next. My teacher told me that I could also do the acid fast stain, however he wouldn't let us actually carry it out. So he drew ...

See entire post

To make things clearer: Acid fast bacteria ARE gram positive, but the structure of their cell wall prevents the ... So if you have a gram positive, it is gram positive, no need for acid fast test. If it is Gram negative, it can be because it is a gram negative, or because it ...

See entire post