Login

|
|
protein sequenceModerator: BioTeam
7 posts • Page 1 of 1
protein sequenceI got this question tomorrow on my final. I believe I have worked out the answer, but I would appreciate some clarification.
There are two DNA sequences listed below which correspond to the sequence of the gene that codes for the protein hemoglobin. One sequence is a normal DNA sequence (i.e., wild type) and the other DNA sequence contains a mutation. For each of the molecules shown below, write the corresponding (i) mRNA sequence and (ii) protein sequence. Will the mutation result in a hemoglobin molecule that is functional? (5 pts) Normal: 5'- ATGCCTTTGCCCCGGTTTCGTATACGG - 3' Mutant: 5' - ATGGCAATGCCCCGGTTTCGTATACG - 3' Normal: 5'- ATGCCTTTGCCCCGGTTTCGTATACGG - 3' Sense 3'- TACGGAAACGGGGCCAAAGCATATGCC- 5' Template mRNA 5'- AUGCCUUUGCCCCGGUUUCGUAUACGG -3' Protein met-pro-leu-pro-arg-phe-arg-IIe-arg Mutant: 5' - ATGGCAATGCCCCGGTTTCGTATACG - 3' Sense 3'- TACCGTTACGGGGCCAAAGCATATGC -5' Template mRNA 5'- AUGGCAAUGCCCCGGUUUCGUAUACG -3' Protein met-ala-met-pro-arg-phe-arg-IIe- Ok then I dont know what to do with the last two. I know that if one base is deleted it changes the amino acids seqence........ok I guess I dont know if it functional or if Im right Help please
There was a depurination right? The structure determines function, frameshift alteration would alter function?
Structure determines function but you do not know if structure is altered in a way that inhibits/enhances function. Strictly speaking, benign missense mutation do exist.
Of course if your professor told you otherwise, I'd stick with his/her story. Living one day at a time;
Enjoying one moment at a time; Accepting hardships as the pathway to peace; ~Niebuhr
In addition to the two point mutations--which may or may not have an effect on function--is the mutant also a frameshift mutation? If it is, then, unless there is a nearby reversion back to the correct reading frame, then the mutant is very likely non-functional. But that's only IF the dropped G is meant to indicate a frameshift. You need to see the wild-type and mutant sequences farther to the right to tell.
I thought it was a framshift mutation due to the deletion. But I dont know, I got all confused because what if these two genes are coming from two seperate individuals, coding for a heterozygous. Then wouldn't the molecule be functional? Mutations to a hemoglobin are recessive??
Im so confused, and over thinking
This may be a made up sequence—not that it matters. Nine residues isn’t much to go on, but Blasting the native sequence didn’t pull out anything at all. I didn’t check your translation, so if that’s in error, then so was the Blast target.
I can always be wrong, but I don’t think dominant/recessive or homozygous/heterozygous was meant to be considered. My best guess is that the question you are to answer is whether or not the mutant chain would be functional in any sense; if this were an alpha-globin, could it team up with beta-globin to yield a functional hemoglobin molecule, say? There are three base changes near the Met introducing two amino acid changes in the mutant relative to the wild type protein. But you can’t say much about function from that—the mutant polypeptide may or may not be functional. I don’t know for sure what was intended by dropping the final G. It would have been nice if they had given you more of the sequence to the right of what we see so we can tell if there really is a frameshift or not. You can’t even say what the ninth residue of the mutant protein is without that information. My answer, to be honest, is that there is insufficient information to make a reasonable prediction. If the dropping of the final G was intended to indicate a frameshift, then most likely the mutant chain is non-functional. But they should have given you more ot the sequence if that’s what they had in mind. You really can't tell from the information you’ve been given, unless you have information you haven’t divulged.
7 posts • Page 1 of 1
Who is onlineUsers browsing this forum: No registered users and 1 guest |

© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy
Science Network - Braintrack.com - University Directory | Chemicool.com - Chemistry | EquationSheet.com - Equations | Logo design by LogoBee