Help with sequencing DNA.

[Melany87]

Alright, I am struggling to find the informational DNA sequence and anti-sense DNA sequence to the resulting informational DNA sequence for the following mRNA sequence:

5' A AG G G U G U A G A A G C U A A G G G U 3'

I contrived the following answers for information sequence, but I do not know if I am correct...
3' T TC C C A C A T C T A C G A T T C C C A 5'

The resulting anti-sense would be:

5' A AG G T G T A G A T G C T A A G G G T 3'

Is that right, or what because I have no found clear distinct guidance in my biology book concerning this...

Any help or guidance is appreciated.

[Melany87]

Ermm.... I noticed on the 2nd AA I stated TA instead of TT and, of course, the antisense would change subsequently.

[kolean]

5' A AG G G U G U A G A A G C U A A G G G U 3'

this is the mRNA, then the sense/coding DNA is the same, but the U's are T's in DNA:

5' A A G G G T G T A G A A G C T A A G G G T 3'

the anti-sense/informational DNA is the opposite:

3' T T C C C A C A T C T T C G A T T C C C A 5'

but most times it is written in the 5' to 3':

5' A C C C T T A G C T T C T A C A C C C T T 3'

[jonmoulton]

For this mRNA:
AAGGGUGUAGAAGCUAAGGGU

The antisense is likely:
ACCCTTAGCTTCTACACCCTT

The sense is likely:
AAGGGTGTAGAAGCTAAGGGT

All sequences are written in standard 5' -> 3' direction.

The reason I write "likely" is that there might be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron.

If there is no splicing event, the mRNA sequence is the same as the sense sequence. Be careful, this is not how the sequences were shown in some of the previous discussion.