Login

Join for Free!
16760 members
table of contents table of contents

Nipah virus (NiV) is an emerging paramyxovirus distinguished by its ability to …


Biology Articles » Virology » Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein » Methods

Methods
- Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

Cell lines

Vero cells, provided by Alison O'Brien (Uniformed Services University), and chicken embryo fibroblast cells (Charles River Laboratories, Inc, Wilmington, MA) were maintained in Eagle's minimal essential medium (Quality Biologicals, Gaithersburg, MD) supplemented with 10% cosmic calf serum (Hyclone, Logan, UT), 2 mM L-glutamine, and 100 units/ml penicillin and streptomycin (Quality Biologicals, Gaithersburg, MD) (EMEM-10). 293T cells were maintained in Dulbecco's modified Eagle's medium (Quality Biologicals, Gaithersburg, MD) supplemented as described above (DMEM-10). All cultures were maintained at 37°C in 7.5% CO2.

Antibodies

The following antibodies were used in immunoprecipitations: Polyclonal rabbit antiserum against NiV F was obtained by immunization of rabbits with a synthetic peptide of the following sequence: CNTYSRLEDRRVRPTSSGDL, which corresponds to the cytoplasmic tail of NiV F. The peptide was conjugated to keyhole limpet hemocyanin (KLH) for immunization. Monoclonal antibodies (MAbs) F45G5 (anti-M) and F45G6 (anti-N) were kindly provided by Jody Berry and Hana Weingartl (National Centre for Foreign Animal Disease, Canadian Food Inspection Agency). MAb M-h (anti-SV5 M) was kindly provided by Robert Lamb (Northwestern University). Mouse antiserum specific for HeV G was provided by Andrew Hickey (Uniformed Services University). Polyclonal serum from a rabbit immunized with gamma-irradiated NiV and from a rabbit immunized with soluble HeV G were also used.

Plasmid and recombinant MVAs

A system for recombinant gene expression using modified vaccinia virus Ankara (MVA) has been described [54]. pMC03ΔE/L, which was made by removing the vaccinia virus promoter from pMC03 by ligation of the vector after PstI digestion, was provided by Katharine Bossart (CSIRO Livestock Industries, Australian Animal Health Laboratory). To introduce the bacteriophage T7 promoter into the vector, complementary oligonucleotides 5'-ggaaattaatacgactcactatagggagaccacaacggtttaaacggcgcgccgga (T7S) and 5'-gatctccggcgcgccgtttaaaccgttgtggtctccctatagtgagtcgtattaatttcctgca (T7AS) were mixed in equal molar amounts, heated to 65°C, then allowed to cool and ligated into the PstI and BglII sites of pMC03ΔE/L to form pMC03T7.

The NiV N ORF was PCR amplified from pCP629 (NiV N gene in pFastBac HTc) using primers 5'-GTTTAAACCACCATGAGTGATATCTTTG (NIVNS) and 5'-GTTTAAACTCACACATCAGCTCTG (NIVNAS). The NiV M ORF was PCR amplified from pCP630 (NiV M gene in pFastBac HTa) using primers 5'-GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5'-GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV F ORF was PCR amplified from pMC02 NiV F [25] using the primers 5'-GTTTAAACCACCATGGTAGTTATACTTGAC (NF2) and 5'-GGCGCGCCCTATGTCCCAATGTAGTAG (NFAS2). The NiV G ORF was PCR amplified from pMC02 NiV G [25] using the primers 5'-GTTTAAACCACCATGCCGGCAGAAAAC (NIVGS) and 5'-GTTTAAACTTATGTACATTGCTCTGG (NIVGAS). PCR was done using Accupol DNA polymerase (PGS Scientifics Corp., Gaithersburg, MD) with the following settings: 94°C for 5 min, then 25 cycles of 94°C for 1 min, 55°C for 2 min, then 72°C for 3 min. The resulting PCR products were sub-cloned into pCRII-Blunt-TOPO (Invitrogen, Carlsbad, CA). TOPO constructs were digested with PmeI or PmeI and AscI, as appropriate, and inserted into PmeI or PmeI-AscI sites in pMC03T7.

The pCAGGS/MCS eukaryotic expression vector has been described previously [72,73]. In order to introduce an AscI site into pCAGGS, 128 pmol of the oligonucleotide 5'-TCGACGGCGCGCCG (CAG1) was heated to 65°C, allowed to cool, and then ligated into the XhoI site of pCAGGS/MCS to form pCAGGS-AscI. The ORFs for NiV N, M, and G, were digested from pMC03T7 as PmeI fragments and ligated into the pCAGGS SmaI site. The ORF for NiV F was digested from pMC03T7 as a PmeI-AscI fragment and ligated into the pCAGGS-AscI SmaI-AscI site. pCAGGS-SV5 M was kindly provided by Robert Lamb.

To create recombinant MVAs, chicken embryo fibroblasts (CEFs) were infected with wild-type MVA at a multiplicity of infection (MOI) of 0.1. At 2 h post-infection, the CEFs were transfected with 8 μg of the appropriate pMC03T7 construct using Profection Mammalian Transfection System – Calcium Phosphate (Promega, Madison, WI). At 4 hr post-transfection, cells were washed, given fresh EMEM-10, and then incubated for 3 days at 37°C. Cells were harvested by scraping, pelleted, and then resuspended in 0.5 ml EMEM-2.5 as crude recombinant virus. After 3 cycles of freezing and thawing, virus was diluted and CEF monolayers were infected overnight at 37°C. Monolayers were then overlaid with EMEM-10 containing 1% low-melting point agarose (Invitrogen, Gaithersburg, MD) and incubated for 2 days. A final overlay of EMEM-10 containing 1% low-melting point agarose and 0.2 mg/ml 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc) (Clontech, Palo Alto, CA) was added to the monolayers and over the following 72 h cells that showed blue staining were picked, resuspended in 0.5 ml EMEM-2.5, and used for repeated positive selection. After 5 or more rounds of purifying positive selection, recombinant MVAs were amplified in CEFs to make crude stocks. Recombinant MVA expressing the bacteriophage T7 RNA polymerase (MVAGKT7) was provided by Gerald R. Kovacs (National Institutes of Health, Bethesda, MD).

Transfection, MVA infection, and metabolic labeling

293T cells in 6-cm wells were transfected in duplicate with pCAGGS constructs using FuGene 6 transfection reagent (Roche, Indianapolis, IN) according to the manufacturer's instructions. Unless otherwise specified, 1 μg of each plasmid was used per well. Empty vector was used to make the total DNA amount 4 μg/well. Vero cells were infected with recombinant MVAs at an MOI of 3–5 in a minimal volume of EMEM containing 2.5% serum. At 24 h post transfection or 6 h post infection, cells were overlaid with methionine-cysteine-free minimal essential medium (MEM) (Invitrogen, Gaithersburg, MD) containing 2.5% dialyzed fetal calf serum (Invitrogen, Gaithersburg, MD) and 100 μCi/ml 35S-cys/met Redivue Promix (Amersham Pharmacia Biotech, Piscataway, NJ), and incubated at 37°C for transfected cells, or 31°C for infected cells. For pulse-chase labeling, cells were washed then starved in methionine-cysteine-free MEM for 45 min followed by metabolic labeling as, as described above, for 15 min. Cells were washed once then chased with DMEM-10.

Immunoprecipitation

Cells were harvested by scraping, pelleted by centrifugation at 5000 × g for 5 min, and then washed once with PBS and pelleted again. The pellet was resuspended in 200 μl lysis buffer (100 mM Tris-HCl, pH 8.0; 100 mM NaCl; 1.0% Triton-X 100) containing Complete, Mini protease inhibitors at a 1× concentration (Roche, Indianapolis, IN), and incubated on ice for 10 min. After removing nuclei by centrifugation, lysates were pre-cleared by incubation with Protein G-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) for 30 min. Lysates derived from a VLP detection assay were frozen at -80°C until immunoprecipitation. Typically 1–2 μl of appropriate antiserum was used for each sample and antisera and lysates were incubated at 4°C overnight, followed by addition of Protein G-Sepharose for 45 min. Protein G beads were washed twice with lysis buffer followed by one wash with lysis buffer containing 0.1% sodium deoxycholate and 0.1% SDS. Proteins were separated either by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gel, or by a NuPAGE Novex 4–12% Bis-Tris gel (Invitrogen, Gaithersburg, MD) and visualized by autoradiography.

VLP assay

293T cells were transfected, and Vero cells were infected with recombinant MVAs, as described above. At 20–24 h p.t. or 48 h p.i., the cell culture medium was removed, clarified, and then centrifuged through a cushion of 10% sucrose (w/vol) in NTE (100 mM NaCl; 10 mM Tris-HCl, pH 7.5; 1 mM EDTA) at 200,000 × g for 2 h at 4°C. The resulting pellet was re-suspended in 4 ml NTE and 1.3 ml 80% sucrose. A discontinuous sucrose gradient was formed by overlaying with 1.8 ml 50% followed by 0.6 ml 10% sucrose in NTE. The gradient was centrifuged at 200,000 × g for 16 h at 4°C in a SW50.1 rotor. Typically, two 0.7 ml fractions were removed from the top of the gradient, diluted with 2× lysis buffer, and analyzed by immunoprecipitation. The two fractions were combined during the first wash after Protein G-Sepharose addition. Proteins from 1/20 of cell lysates from MVA infections, and half of cell lysates from transfected cells, were used for immunoprecipitation. For samples derived from transfection, 1/3 of the sample was loaded on gels (equivalent to 1/6 total lysate). Release efficiency was quantified by performing densitometry analysis on scanned film images using AlphaEaseFC software (Alpha Innotech Corporation, San Leandro, CA). Percent release was calculated as the fraction of protein derived from the supernatant divided by total protein detected (total lysate + supernatant).

Equilibrium centrifugation

Clarified culture supernatants of MVA-infected Vero cells were centrifuged at 200,000 × g for 2 h at 4°C. The resulting pellet was resuspended in 200 μl NTE and added to the top of a continuous gradient of 5–45% sucrose. Clarified supernatants from transfected cells were added directly to the gradient. The gradient was centrifuged in an SW40 Ti rotor at 200,000 × g for 16 h at 4°C. Fractions were collected from the bottom and 50 μl of each fraction was set aside for density measurement. The remainder of each fraction was combined with 4× lysis buffer (pH 7.5) and immunoprecipitated as described. Density was determined based on refractive index as measured with a refractometer. Culture supernatants of NiV-infected Vero cells were clarified at 20,000 × g for 10 min at room temperature and 100 μl of clarified supernatant containing approximately 106 TCID50 was added to the top of a continuous gradient of 5–45% sucrose. The gradient was centrifuged in an SW41 Ti rotor at 200,000 × g for 16 h at 4°C. Fractions were collected from the bottom and 50 μl of each fraction was set aside for density measurement. A portion (140 μl) of each fraction was extracted using the QIAamp Viral RNA Mini kit (Qiagen GmbH, Hilden) and extracted RNA was analyzed by quantitative real-time PCR as previously described [74]. Threshold cycle (Ct) values were used as a proxy for virus concentration and density was determined based on refractive index as measured with a refractometer.

Electron microscopy

VLPs released from transfected 293T cells into the culture supernatant were prepared as described above except the top 1.4 ml of the flotation gradient was mixed with 3 ml of PBS and centrifuged for an additional 2 h after which the pellet was resuspended in 60 μl PBS. VLPs were adsorbed onto carbon-coated parlodion copper grids and immunolabeled using either polyclonal HeV G-specific mouse antiserum or anti-NiV M monoclonal antibody F45G4, followed by secondary antibody conjugated to 12 nm gold beads. For detection of M, immuno-labeling was done in the presence of 0.05% saponin. Samples were negatively stained with 1% uranyl acetate and examined with a Hitachi 7600 transmission electron microscope operated at 80 kV.


rating: 0.00 from 0 votes | updated on: 10 Oct 2007 | views: 587 |

Rate article:







excellent!bad…