Samples
After informed consent was obtained, 157 healthy volunteers (83 males and 74 females; age 36.2 ± 8.4 years) were enrolled in this study. The information on drinking and smoking habits was collected by questionnaire. Volunteers were asked the frequency of drinking (nondrinker, rare drinking, 1-2 times/wk, 3-5 times/wk, almost every day), and smoker or nonsmoker. Various lipid parameters (TC, TG, LDL-C, HDL-C, ApoA-I, apoB, apoE and Lp (a)) were measured by EDTA・2Na, and hepatic functions (AST, ALT and g-GTP) were measured by serum. Blood samples for plasma 8-isoprostane assay were collected in the specific tubes containing 10 mmol/L EDTA・3Na, 20 kU/L Trasylol and 0.1 mmol/L indomethacin, and were separated within 4 h in an ice cooling both. Among the 157 subjects, plasma (heparin) samples were also collected from 3 healthy volunteers to test whether these samples could be used interchangeably for the 8-isoprostane assay. Furthermore, another 3 healthy volunteers as control subjects (2 males, 1 female; age 36.2 ± 8.4 years) were given alcohol (0.5-1.3 g/kg), and their plasma 8-isoprostane, serum AST, ALT, and g-GTP were measured on D1 (ca. 12 h) and 2 (ca. 36 h) after drinking to investigate the influence of alcohol on these levels. All plasma and serum samples were stored at -80℃ until analysis.
Extraction of 8-isoprostane from plasma samples
A two-step solid-phase extraction procedure that was previously used for quantifying plasma TXA2[21] was modified for the purification of plasma 8-isoprostane. In principle, the first step of the extraction was performed to remove proteins and lipids using ODS gel (ODS-Q3; Fuji Gel, Tokyo, Japan) and the second step was used to separate 8-isoprostane from its analogues and related compounds using an NH2 Sep-Pac column (Sep-Pak Vac NH2; Waters, MA, USA). To optimize the extraction conditions, 3H-labeled 8-isoprostane and other related compounds including PGF2a, TXB2, 6-keto-PGF1, PGE2 and PGD2 (Cayman Chemical, MI, USA) were used as spiked tracers.
Extraction and measurement of 8-isoprostane
The detailed procedure for plasma 8-isoprostane extraction is shown in Figure 1. One milliliter of ODS gel suspension (80 mg silica gel ODS-Q3 in 0.1 mol/L HCl containing 40 mL/L ethanol) was mixed with 0.5 mL of plasma and allowed to stand at room temperature for 5 min. The gel was collected by centrifugation and washed twice with 1 mL of 0.03 mol/L HCl containing 150 mL/L ethanol and once with 1 mL of petroleum ether to remove proteins and lipids. 8-isoprostane was eluted from the gel twice using 1 mL of ethyl acetate for each elution. The eluates were combined, transferred to another test tube and dried under N2 gas. The residue containing 8-isoprostane was dissolved in 1 mL of solution A (hexane: 2-propanol: acetic acid = 90:10:0.5, V/V/V), and applied to an NH2 Sep-Pak column pre-equilibrated with solution A. The column was washed once with 5 mL of solution A, followed by another wash with 5 mL of solution B (hexane: 2-propanol: acetic acid = 75:25:0.5, V/V/V). Finally, 8-isoprostane was eluted from the column with solution C (hexane: 2-propanol: acetic acid = 45:55:0.5, V/V/V) and dried under N2 gas. The residue was dissolved in 1 mL of the assay buffer included in the 8-isoprostane ELISA kit (Cayman Chemical). The ELISA was performed according to the manufacturer’s instructions without further purification of the samples, and the absorbance was measured with a plate reader (V-Max; Molecular Dynamics, NJ, USA). The 8-isoprostane standards included in the ELISA kit were extracted in the same way as the samples to obtain a calibration curve, which was used to estimate the 8-isoprostane levels in the samples.
Effect of interfering substances on the assay
Interference with the 8-isoprostane assay was tested before and after the addition of free and conjugated-bilirubin (up to 342 mmol/L), hemoglobin (up to 5 g/L) and triacylglycerol (up to 55 mmol/L) to each plasma sample. A concentrated reagent set of the interfering substances was purchased from International Reagents Co. Ltd. (Hyogo, Japan).
Storage stability of plasma 8-isoprostane under various conditions
Plasma samples were collected from the 3 control subjects using special tubes as described above. Aliquots of the samples were separately stored at -80℃, 4℃ and 25℃. The 8-isoprostane levels were tested within 4 h after the blood collection and on d 1, 3, 7, 14, 21, 28 and 120 using fresh aliquots of the samples at each time point.
Determination of other lipid profiles and hepatic functions in blood samples
The concentration of TC, TG, LDL-C and HDL-C were determined by an enzymatic method (Kyowa Medics Co. Ltd, Tokyo, Japan). ApoA-I, apoB, apoE and Lp (a) were measured by using immunoturbidimetric assay kits (Daiichi Pure Chemicals Co. Ltd., Tokyo, Japan). AST and ALT were determined using UV method[22] and g-GTP were determined by L-g-glutamyl-3-carboxy-4-nitroanilid substrate method[23].
Genotyping of ALDH2
DNA was extracted from blood samples collected with EDTA・2Na using a commercially available kit (Sanko Pure Chemicals Co. Ltd., Tokyo, Japan). Mismatched PCR primers for determining the ALDH2 genotypes were designed with reference to the ALDH2 gene sequence (GenBank Accession No. AH002599). The wild-type allele (ALDH2*1) of ALDH2 was amplified using the forward and reverse primers CAAATTACAGGGTCAACTGCTATG and CCACACTCACAGTTTTCACTTC, respectively. The mutant type (ALDH2*2) of ALDH2 was amplified using the forward and reverse primers CAAATTACAGGGTCAACTGCTATG and CCACACTCACAGTTTTCACTTT, respectively. Amplification was performed in 25 mL of 1 × Qiagen PCR buffer containing 0.2 mmol/L of each ALDH2 primer, 200 mmol/L of each dNTP, and 2 U of HotStartTaq DNA polymerase (Qiagen, Hilden, Germany). The PCR conditions were denaturation at 95℃ for 10 min, followed by 35 cycles of amplification (30 s at 94℃, 30 s at 58℃ and 30 s at 72℃). After electrophoresis in a 25 g/L agarose gel, the 135-bp PCR products were stained with ethidium bromide and visualized under UV light.
Statistical analysis
Statistical analyses of the data were performed by the paired t-test using the In Stat computer software (version 3.06; GraphPad Software Inc.). The correlation between two variables was calculated by the non-parametric Spearman rank coefficient test. A corrected value of P