Login

Join for Free!
17877 members
table of contents table of contents

Biology Articles » Hydrobiology » Fate of Heterotrophic Microbes in Pelagic Habitats: Focus on Populations » Table

Table
- Fate of Heterotrophic Microbes in Pelagic Habitats: Focus on Populations

..................................................


TABLE 1. Some oligonucleotide probes targeted to clades of marine and freshwater heterotrophic picoplankton

Plankton type Probe name Target group Sequence (5'-3') FAa(%) Escherichia coli 16S rRNA positionb Reference or source
Marine CREN-554 GI Crenarchaeota TTAGGCCCAATAATCMTCCT 20 554-573 176
EURY-806 GII Euryarchaeota CACAGCGTTTACACCTAG 20 806-823 296
ROS-537 Roseobacter clade (Alphaproteobacteria) CAACGCTAACCCCCTCC 55 537-554 63
SAR11-441 SAR11 clade (Alphaproteobacteria) TACAGTCATTTTCTTCCCCGAC 45 441-462 188
SAR116/1-447 Cluster 1 of SAR116 clade (Alphaproteobacteria) GCTACCGTCATCATCTTC 65 447-464 71
SAR116/2-436 Cluster 2 of SAR116 clade (Alphaproteobacteria) CATCTTCACCAGTGAAAG 45 436-452 71
OM43-162 OM43 clade (Betaproteobacteria) ATGCGGCATTAGCTAACC 55 162-179 262
SAR86-1245 SAR86 cluster (Gammaproteobacteria) TTAGCGTCCGTCTGTAT 55 1245-1262 325
NOR5-730 NOR5 subcluster of OM60 clade (Gammaproteobacteria) TCGAGCCAGGAGGCCGCC 55 730-747 63
ALT-1413 Alteromonas spp., Colwellia spp. (Gammaproteobacteria) TTTGCATCCCACTCCCAT 50 1413-1430 62
GV-841 Vibrio spp. (Gammaproteobacteria) AGGCCACAACCTCCAAGTAG 50 841-822 62
PSA184 Pseudoalteromonas spp., Colwellia spp. (Gammaproteobacteria) CCCCTTTGGTCCGTAGAC 50 184-210 62
CF6-1267 DE cluster 2 (Cytophaga-Flavobacterium) GAAGATTCGCTCCTCCTC 40 1267-1284 144
SAR406-97 SAR406 cluster (Chlorobium-Fibrobacter) CACCCGTTCGCCAGTTTA 65 97-114 71
SAR202-104 SAR202 clade (Chloroflexus) GTTACTCAGCCGTCTGCC 104-131 189
Freshwater R-BT065 Beta I lineage of limnic Betaproteobacteria GTTGCCCCCTCTACCGTT 55 65-72 278
Bet2-870 Beta II lineage of limnic Betaproteobacteria CCCAGGCGGCTGACTTCA 55 870-881 35
SOL-852 SOL cluster (filamentous Saprospiraceae) ACGCTTTCGCTTGGACAC 852-869 255
LD2-739 LD2 clade (subgroup of SOL cluster) GCGTCAATACAGATCCAG 55 739-757 223
HAL-844 Haliscomenobacter cluster (subgroup of SOL cluster) CGCTTGGACACTCACTCC 844-861 255
Acl-1214 acl lineage of limnic Actinobacteria CATGCGTGCAGCCCAAGACA 55 1214-1233 310
Acl-840-1 sub-group 1 of acl lineage TCGCACAAACCGTGGAAG 30 840-857 310
Acl-840-2 sub-group 2 of acl lineage TCGCAGAAACCGTGGAAG 30 840-857 310
Acl-840-3 sub-group 3 of acl lineage TCGCAGAGACCGTGGAAG 30 840-857 310
Acl-840-H1 unlabeled helper for Acl-840 probesc CTAGYGCCCAYCGTTTACGG 30 810-829 91
Acl-840-H2 unlabeled helper for Acl-840 probesc GTTCSCACAACTAGYGCCCA 30 820-839 91
Acl-840-H3 unlabeled helper for Acl-840 probesc GGGGCRCTTAATGCGTTAGCTG 30 859-880 91

a If available, stringent conditions for hybridization (% of formamide [FA] in the wash buffer) are given for CARD-FISH as described (211).

b Probe target position according to reference 33.

c Unlabeled helper oligonucleotides are added at a 1:1 concentration to hybridization mixes according to reference 70.


..................................................

Source: Microbiology and Molecular Biology Reviews, September 2005, p. 440-461, Vol. 69, No. 3


rating: 4.91 from 11 votes | updated on: 19 Dec 2006 | views: 3265 |

Rate article:







excellent!bad…