Construction of the reporter plasmids
Restriction enzymes, T4 polynucleotide kinase, T4 DNA ligase, Deep Vent DNA polymerase and Klenow DNA polymerase were acquired from New England Biolabs (Beverly, MA). DNA sequencing and deoxyribonucleotide synthesis were carried out by the Yale University W.M. Keck core facility. The vector pBAD-GFPuv (Crameri et al., 1996
) has the ColE1 origin which is also present in pBR322, in which the nucleotide immediately before the +1 position of RNA I is a guanine. In contrast, the ColE1 origin of pUC19 has an adenine in this position. The plasmid pUCBADGFPuv (Figure 2) was constructed by digesting both pBAD-GFPuv and pUC19 with AlwNI and BglI and ligating the smaller, origin-containing fragment from pUC19 into the pBAD-GFPuv vector. The presence of the –1 adenine was confirmed by sequencing. The plasmid pUClacGFPuv was created by digesting pUCBADGFPuv with ClaI and NheI to excise the arabinose promoter and araC gene. The lac promoter from pUC19 was amplified by PCR with ClaI and NheI ends using the synthetic DNA oligonucleotides 5'-aataatatcgatgcgcaagcgaattggtgtg-3' and 5'-aataatgctagccatagctgtttcctgtgtgaaattg-3'. The PCR product was digested appropriately and ligated into the digested pUCBADGFPuv vector.
Construction of the Rop screening plasmids
For ease of future library manipulations and to prevent complicating effects of autoregulation of Rop’s template, a second compatible plasmid was engineered for Rop expression in the screen. The plasmid pACYC177lacRop was created by digesting pACYC177 with BamHI and BanI and ligating a fragment with a synthetic lac promoter and rop gene (created by overlap PCR and digested with the same restriction enzymes). The insert was created by Klenow extension of the deoxyribonucleotides 5'-aaggaaggatcctttacactttatgcttccgg ctcgtatgttgtgtggaattgtgagcggataa-3' and 5'-ggttttttcctgtttggtcatatgtgtttcctgtgtgaaattgttatccgctcacaattccaca-3' and PCR amplification of rop from pBR322 using the deoxyribonucleotides 5'-catatgaccaaacaggaaaaaacc-3' and 5'-aaggaaggcacctcagagg ttttcaccgtcatc-3'. These two products were mixed and subjected to PCR amplification using the latter rop amplification primer and 5'-aaggaaggatcctttacac-3'. The vector used for screening, pAClacRop (Figure 2), was additionally modified to contain a synthetic T7 promoter before the lac promoter by insertion between the BstEII and BamHI sites of pACYC177lacrop. The inserted sequence was created by mixture and phosphorylation of the deoxyribonucleotides 5'-gtcacctaatacgactcactatag-3' and 5'-gatcctatagtgagtcgtatttag-3'. The T7 promoter had no apparent effect on lac-driven Rop expression in DH10B E.coli; however, no expression of Rop was detected upon IPTG induction when pAClacrop was transformed into BL21(DE3) E.coli.
The negative control plasmid pAClacLink was created by digestion of pAClacRop with NdeI and BanI and ligation of a phosphorylated fragment created by admixture of the deoxyribonucleotides 5'-tatggcatgacgtcgcatg-3' and 5'-gcaccatgcgacgtcatgcca-3'. This created an AatII-cleavable linker in the Rop expression cassette. This linker was exchanged for the CmR gene from pACYC184 by PCR amplification of the gene for CAT using the deoxyribonucleotides 5'-aataataatcatatgagaaaaaaatcactggatatacc-3' and 5'-aataatggcaccttacgccccgccctgccactcatcg-3', creating the vector pAClacCm.
Plasmids for expression of Rop variants Ala2Leu2-4 (Rop23), Ala2Leu2-8-rev (Rop29), Ala2Met2-8 (Rop39) and Leu4-8 (Rop47) were created by PCR amplification of the appropriate genes from plasmids created by Munson (Munson et al., 1994a
,b, 1996
) using deoxyribonucleotides that encode NdeI and BanI-cleavable ends. These deoxyribonucleotides vary slightly with the Rop sequence, but, for example, those used to amplify Rop23 are 5'-aataataatcatatggggaccaaacaggagaaaacc-3' and 5'-aataatggcacctcagaggttttcaccgtcatc-3'. These digested PCR products were ligated into appropriately digested pAClacLink. The Ala2Leu2-2 variant was created synthetically by Klenow extension of the deoxyribonucleotides 5'-accaaacaggaaaaaaccgcccttaacatggcccgctttc tgagaagccaggcgttaacgcttctggagaaactcaacgagctggacgcggatg-3' and 5'-accgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatccgcgtggtcgtgcagcgattcacagatatctgcctgttcatccgcgtccagctcg-3' followed by PCR amplification with 5'-cacaggaaacacatatga ccaaacaggaaaaaacc-3' and 5'-cagtgaggcacctcagaggttttcaccgtcatcaccgaaacg-3'. The resulting product was digested and ligated as with the other Rop variants.
Screening Rop variants
Positive and negative screening strains were created by transforming electrocompetent DH10B E.coli with pUCBADGFPuv or pUClacGFPuv, respectively. DH10B is a robust cloning strain from which high-efficiency electrocompetent cells can easily be prepared by standard methods. Electrocompetent cells of these strains were then transformed with the appropriate pAClac plasmid (e.g. pAClacRop for positive control or pAClacLink for negative control). Cells were plated on LB agar supplemented with 100 µg/ml ampicillin, 35 µg/ml kanamycin, 100 µM IPTG and 0.0005% arabinose and grown for 16 h at 42°C. (The IPTG and arabinose can optionally be omitted with the pUClacGFPuv-based negative screening strain.)
To examine the copy number of the ColE1 plasmids directly, a 5 ml culture of the doubly transformed E.coli of interest was grown overnight at 37 or 42°C in LB/Amp/Kan and 1 ml of that culture was subjected to alkaline lysis miniprep (Qiagen). The isolated DNA was digested with AatII and XmaI (which makes a single cut in the pUC...GFPuv vectors, a single cut in the pAClacRop vector and two cuts in the pAClacLink vector) and analyzed by agarose gel electrophoresis.
Plasmid sequences
The sequences of the pUC...GFPuv and pAClac... vectors will be available on the Regan Group Website Publications page (http://www.csb.yale.edu/people/regan/publications.html).